Cell Biology Protocols

9.Wash wells 3× in deionized water and let them dry out for 1–2 h.

10.Count cells using a phase contrast microscope.

Fractin staining

Fractin is a cleavage product of actin after its processing by caspase-1 and caspase- 3, we used an affinity-purified antibody provided by Dr Greg Cole to detect fractin. This antibody has been tested in vitro on mice and can also be used on human and mouse brain sections with a few adaptations.

1.Wash cells 3× with PBS, then block and permeabilize in PBS 10% FCS/ 0.2% Triton for 1h at room temperature.

2.Incubate overnight at 4 ◦C with purified primary antibody diluted 1/2000 in PBS 10% SVF/0.2% triton.

3. Wash wells 3× with PBS, incubate

2 h at room temperature with secondary biotinylated anti-rabbit antibody from Vectastain ABC-AP (alkaline phosphatase) kit at 1/200 in PBS 5% SVF/0.2% triton.

4.Wash wells 3× again with PBS, incubate 1 h at room temperature with A +

B complex from ABC-AP Vectastain kit at 1/200 (A + B complex was preformed for 40 min in PBS).

5.Wash wells 3× with PBS, add 100 µl of NBT/BCIP substrate solution and incubate for approximately 10 min at room temperature. Follow the course of the reaction and block it by adding 10 µl of 0.5 M EDTA in the wells when the staining is intense enough.

6.Wash wells 3× with deionized water and let them dry out for 1–2 h.

PROTOCOL 6.15

261

p20 staining

The p20 antibody (Pharmingen) is targeted against the active (17–22 Kd) form of caspase-3 which is a cleavage product of a larger (37 Kd) propeptide; it can be used for Western blots with a few adaptations.

The immunocytochemistry procedure is exactly the same as for the fractin staining except that the dilution for the purified primary antibody is 1/500. So far, this antibody has been used on human and murine cells.

Inhibition of apoptosis

In our hands, the irreversible caspase inhibitors zVAD-fmk at 100 µM and zDEVD-fmk at 200 µM were effective at inhibiting apoptosis occurring through caspase-3 activation. We also used antisense oligonucleotides coupled to cellpermeant peptides as described by Troy et al. [4] at a concentration of 200 nM.

Oligonucleotide sequences directly coupled to the cell-permeant vector penetratin are commercially available from Quantum Biotechnologies. The penetratin peptide and its properties have been described in detail by Derossi et al. [5] and Dupont et al. [6]. Its amino acid sequence is: RKQIKIWFQNRRMKWKK.

The oligonucleotides used were designed by Troy et al. [4] and their sequences are:

Sequence for antisense caspase-1 CCTCAGGACCTTGTCGGCCAT

Sequence for antisense caspase-3 GTTGTTGTCCATGGTCACTTT

These sequences correspond to rat caspases; if you investigate another species you should check these sequences and modify the oligonucleotides accordingly. The caspase-3 antisense oligonucleotide has proven effective on murine cells [7].

Note that the peptide/oligonucleotide conjugate should be kept away from reducing agents as the two parts are linked by a disulfide bond. The coupling takes place

262 IN VITRO TECHNIQUES

40

%age of TUNEL-positive cells

30

20

10

0

Ctrl

J 0.25 M

J 0.5 M

J 1 M

Figure 6.11 Toxicity of peptide J on primary cultures of cortical neurons (error bars represent standard deviation)

between a thiol function at the 5 end of the nucleotide and a modified cysteine at the N -terminal part of the penetratin peptide. More details on the chemistry involved in the coupling can be found in Troy et al. [8] and Dupont et al. [6].

Examples

The cell-permeable peptide J has been used to induce apoptosis; it contains a cytoplasmic juxtamembrane sequence of the amyloid precursor protein (APP) linked to a penetratin vector. Our intent was to simulate an excessive generation of amyloid precursor protein (APP) juxtamembrane fragments by internalizing J in cortical neurons (more detail in Bertrand et al. [7]).

Peptide J RKQIKIWFQNRRMKW KKKYTSIHHG

(APP juxtamembrane sequence is underlined)

The following experiments were performed on E15 rat cortical neurons which were cultured in ELISA wells precoated

with polyornithine, as in ref. 7. The treatments were applied 2 h after plating; whenever necessary the cells were incubated with ZVAD 1 h before peptide J addition.

We first wanted to determine whether this peptide was toxic at concentrations in the micromolar range. We compared the number of TUNEL-positive cells of four conditions after 24 h of culture: neurons treated with 0.25 M, 0.5 M, 1M of peptide J and untreated controls (Figure 6.11). For each condition, about 300 cells were counted on the diameter of six ELISA wells (for a total of 2000). There is no significant difference between control, J 0.25 M and J 0.5 M conditions (Student, p > 0.05), whereas the percentage of TUNEL positive cells is higher for J 1 M than for the control (Student, p < 0.001). We conclude that the peptide J is toxic at 1 M but not at the lower concentrations.

In the next experiment we tested whether the toxicity of the peptide J can be blocked by the caspase inhibitor ZVAD

PROTOCOL 6.15

263

%age of TUNEL-positive cells

40

30

20

10

0

Ctrl

J 1 M

ZVAD

J/ZVAD

Figure 6.12 The caspase inhibitor ZVAD reduces the toxic effect of peptide J (error bars represent standard deviation)

(Figure 6.12). We studied rat E15 cortical neurons and observed the effect of ZVAD on J 1 M treated and untreated cells, these cells were fixed after 18 h of treatment. For each condition, 300 cells were counted on the diameter of one ELISA well, and the experiment was repeated three times with similar results. The toxicity of peptide J is very effectively reduced by ZVAD which also reduces TUNEL-staining in the control (p < 0.001 in both cases, Khi2 test). This means that the toxic effect of peptide J is mediated by the caspases and that the TUNEL-staining in our system is caused by apoptosis.

Data on the activation of caspase-3 by APP juxtamembrane peptides can be found in Bertrand et al. [7], along with some in vivo results.

References

1.Jacobson, M. D., Weil, M. and Raff, M. C. (1997) Programmed cell death in animal development. Cell, 88, 347–354.

2.Nagata, S. (1997) Apoptosis by death factor. Cell, 88, 355–365.

3.Garcia-Calvo, M., Peterson, E. P., Leiting, B., Ruel, R., Nicholson, D. W. and Thornberry, N. A. (1998) Inhibition of human caspases by peptide-based and macromolecular inhibitors. J. Biol. Chem., 273, 32 608–32 613.

4.Troy, C. M., Rabacchi, S. A., Friedman, W. J., Frappier, T. F., Brown, K. and Shelanski, M. L. (2000) Caspase-2 mediates neuronal cell death induced by beta-amyloid. J. Neurosci., 20, 1386–1392.

5.Derossi, D., Chassaing, G. and Prochiantz, A. (1998) Trojan peptides: the penetratin system for intracellular delivery. Trends Cell Biol., 8, 84–87.

6.Dupont, E., Joliot, A. and Prochiantz, A. (2002) Penetratins. In: CRC Handbook on Cell

¨

Penetrating Peptides U. Langel, ed.), CRC Press.

7.Bertrand, E., Brouillet, E., Caille, I., Bouillot, C., Cole, G. M., Prochiantz, A. and Allinquant, B. (2001) A short cytoplasmic domain of the amyloid precursor protein induces apop-

tosis in vitro and in vivo. Mol. Cell. Neurosci.,

18, 503–511.

8. Troy, C. M., Derossi, D., Prochiantz, A., Greene, L. A. and Shelanski, M. L. (1996) Downregulation of Cu/Zn superoxide dismutase leads to cell death via the nitric oxide–peroxynitrite pathway. J. Neurosci., 16, 253–261.

PROTOCOLS 6.16–6.20

The mitochondrial permeability transition [1–5]

Judie B. Alimonti and Arnold H. Greenberg†

Introduction

Mitochondrial permeability transition (PT) occurs when the PT pore opens allowing solutes and water to enter the mitochondrial matrix, often accompanied with the loss of the mitochondrial membrane potential ( m). Direct measurement of the opening of the PT pore is best ascertained using calcein AM. The non-fluorescent calcein AM is membrane permeable, and upon entering the cell is cleaved by esterases to become fluorescent and membrane impermeable. CoCl2 is added to eliminate calcein fluorescence in the cytoplasm so that only the mitochondria will

fluoresce. Calcein exits the mitochondria only upon opening of the PT pore, therefore it is an indicator of PT. Since a closed PT pore is required to maintain m, the loss of m can also be used to determine PT. However, remember that loss of m can occur independently of PT, therefore you must verify that it is due to PT by either adding a PT inhibitor or calcein AM. The utilization of fluorescent cationic dyes that accumulate around a membrane with a transmembrane potential allow the measurement of m. The stronger the membrane potential the more dye accumulates at a membrane.

PROTOCOL 6.16

The mitochondrial permeability transition: PT and m loss determined in cells or isolated mitochondria with confocal laser imaging

[2, 4, 5]

Equipment

For cells and isolated mitochondria

Chambered glass coverslips (e.g. Nunc 12- 565-103N)

Inverted confocal microscope

Pipette and tips

Polystyrene ice container and ice

Tabletop centrifuge and rotors

Reagents

For cells and isolated mitochondria

Calcein AM (1 mM stock in DMSO)

Tetramethylrhodamine (TMRM: 10 mM

stock in DMSO)

Carbonylcyanide m-chlorophenylhydra-

zone (CCCP: 100 mM stock in DMSO)

Cyclosporin A (10 mM stock in ethanol)

For cells only

Tissue culture medium

Cell buffer: Hanks balanced salt solutions (HBSS), 10 mM Hepes pH 7.2

For isolated mitochondria only

Buffer H: 300 mM sucrose, 5 mM TES, and 200 µM EGTA, pH to 7.3 with NaOH. (TES = N-tris[hydroxymethyl]- methyl-2-aminoethanesulfonic acid).

Freshly isolated mitochondria and S100 (see Protocols 4.7–4.10)

Assay buffer: 220 mM sucrose, 68 mM mannitol, 10 mM Hepes-KOH, 10 mM KCl, 5 mM KH2PO4, 2 mM MgCl2, 0.5 mM EGTA, 5 mM succinate, 2 µM rotenone, pH 7.2

Procedure

Cells

1.Seed adherent cells onto a chambered

glass coverslip. 1 Incubate 1–2 days in a humidified 37 ◦C/ 5% CO2 incubator until the cells are in log phase.

2.Pretreat the cells with any PT inhibitors (i.e. 10 µM cyclosporin A or 50 µM Bongkrekic acid) as necessary before

incubating the cells with the PT inducers for the required times. 2

3.Gently wash the cells twice and resuspend in cell buffer.

4.Load the cells with the fluorescent

marker. Add 1 µM calcein AM and 1–5 mM CoCl2. 3 Incubate for 10–15 min at room temperature. Wash four times then resuspend in cell buffer.

5.Imaging is performed on an inverted confocal microscope using a band bypass filter of 488 nm for calcein, and

266 IN VITRO TECHNIQUES

Nomarski optics for transmitted light images of the same cells. Cells containing mitochondria with a closed PT pore will fluoresce whereas the cells that have undergone PT have less or no fluorescence. The level of fluorescence per cell can then be quantitated using imaging software, along with the number of cells with high, medium or low levels of fluorescence. 4 If you are also using 100 nm TMRM to measure m in the same cells then you will have to switch the optics back and forth from 488 nm for calcein, to a band bypass filter of 568 nm for TMRM.

Isolated mitochondria

1.Add 20 µg/ml freshly isolated mitochondria in H buffer to a chambered

coverslip. 5 Centrifuge at 1475g,

5min, 4 ◦C. Wash off the excess layers of mitochondria. 6

2.Resuspend in assay buffer containing

100nM TMRM, 8 µM calcein AM. Incubate 10–15 min at room temperature. Wash four times and resuspend in assay buffer with TMRM, along with the S100 if required.

3. Pretreat with any PT inhibitors			(i.e.
10 µM	cyclosporin A,	30 min	or
50 µM	Bongkrekic acid)	as necessary

before incubating the mitochondria with the PT inducers for the required times.

4.Imaging is performed on an inverted confocal microscope using a band bypass filter of 488 nm for calcein, and 568 nm for TMRM. Take an image before adding the PT inducer, then at

various time points to follow PT and loss of m. 7

Notes

1 For non-adherent cells you can cytospin them onto a glass coverslip, dry off the surrounding area and apply a

non-toxic, non-reactive grease around the cells to form a well. Alternatively, you can use a polylysine-coated chambered coverslip to help the cells adhere.

2 If your PT inducer acts rapidly then you can stain your cells with the fluorophores first and take a baseline picture on the confocal microscope before adding your PT inducer and following the loss of fluorescence.

3 CoCl2 is toxic to the cells over extended times, therefore must be washed out. You may have to adjust the CoCl2 concentration for each cell line to determine the minimum concentration of CoCl2 required to quench the cytoplasmic calcein yet remain non-toxic.

4 If you induce PT before staining then you must standardize the staining and confocal settings for all of the samples. Remember to include an untreated sample for your negative control, and CCCP 50–100 µM treatment for your positive control. The PT inhibitor cyclosporin A (10–20 µM) can be added to block the PT inducers to verify your test substance works on the PT pore.

5 Alternatively, add 20 µg/ml freshly isolated mitochondria in H buffer to a six-well plate containing a 22 × 30 mm coverslip. Centrifuge at 1475g, 5 min, 4 ◦C. The coverslip can either be added to an enclosed heated stage that passes buffer over it, or dry off the surrounding area and apply a non-toxic, non-reactive grease around the mitochondria to form a well.

6 Mitochondria are sticky but adhere loosely to the coverslip, so you will have to gently wash off the excess multiple layers of mitochondria for

easier viewing on the confocal microscope.

7 The	confocal laser can induce PT
in	isolated	mitochondria, therefore
limit the exposure to the laser, and
include an		untreated mitochondria

PROTOCOL 6.16

267

sample for the same time period as the experiment to determine the stability of the mitochondria under experimental conditions. CCCP 50–100 µM treatment is your positive control.

PROTOCOL 6.17

The mitochondrial permeability transition: measuring PT and m loss in isolated mitochondria with Rh123 in a fluorometer [1, 2]

Reagents

Freshly isolated mitochondria and S100 (see Protocols 4.7–4.10 )

Carbonylcyanide m-chlorophenylhydra-

zone (CCCP: 100 mM stock in DMSO)

Rhodamine 123 (Rh123) (16 mM stock in DMF)

Cyclosporin A (10 mM stock in ethanol)

Assay buffer: 220 mM sucrose, 68 mM mannitol, 10 mM Hepes-KOH, 10 mM KCl, 5 mM KH2PO4, 2 mM MgCl2, 0.5 mM EGTA, 5 mM succinate, 2 µM rotenone, pH 7.2

Equipment

Fluorometer

96-well non-fluorescent black plates

Pipettes and tips

5% CO2/37 ◦C humidified incubator

Procedure

plate with a final mitochondrial concentration between 0.75 and 1 mg/ml and a minimum volume of 0.1 ml/well. Also add the S100 if required.

2.The positive control for m loss is CCCP (50–100 µM final). Pretreatment with PT inhibitors like cyclosporin A (10–20 µM, 30 min) should be used to verify that the m loss is due to PT.

Add the PT inducers for the required time at 37 ◦C.

3. Add the fluorescent dye Rh123 (5 µM). 1 The fluorometer requires an excitation/emission filter of 485/535 nm. Take readings during the linear range (5–20 min) of the accumulation of Rh123. 2 3

Notes

1 As Rh123 accumulates around respiring mitochondria the fluorescence decreases since Rh123 fluorescence is quenched at high concentrations, so the higher the m the lower the fluorescence. This is unique to Rh123.

1. Load freshly isolated mitochondria in	2 The results can be expressed as the
assay buffer in triplicate onto a 96-well	percentage of maximum m loss,

using the CCCP sample as the maximum loss. The mitochondria will deteriorate with time and the background increases with longer incubations.

3 Alternatively, you can incubate the mitochondria with Rh123 until the

PROTOCOL 6.17

269

quenching is complete. You then add your PT inducer and watch for the increase in fluorescence.

PROTOCOL 6.18

The mitochondrial permeability transition: measuring PT and m loss in cells and isolated mitochondria on the FACS [1, 4, 5]

Equipment

FACS and FACS tubes

Pipettes and tips

Polystyrene ice container and ice 5% CO2/37 ◦C humidified incubator Tabletop centrifuge

Reagents

Freshly isolated mitochondria and S100 (see Protocols 4.7–4.10 )

Rh123 (16 mM stock in DMF)

JC-1 (10 mg/ml stock in DMSO)

DiOC6 (3) (100 µM stock in DMSO)

For cells: Hanks balanced salt solution (HBSS), 10 mM Hepes pH 7.2

For mitochondria: Assay buffer: 220 mM sucrose, 68 mM mannitol, 10 mM Hep- es-KOH, 10 mM KCl, 5 mM KH2PO4, 2 mM MgCl2, 0.5 mM EGTA, 5 mM succinate, 2 µM rotenone, pH 7.2

Procedure

Cells

1.Treat the cells with the PT inhibitors and inducers for the required times. 1 Wash the cells twice with HBSS,

10 mM	Hepes pH	7.2. Resuspend at
1 × 106	cells in 21	ml HBSS, 10 mM
Hepes pH 7.2.

2.Label the cells with the Rh123 (2 µM) for 10 min at room temperature. 2 Read on a FACS in FL1.

Mitochondria

1.Pre-incubate 50 µg/ml of freshly iso-

lated mitochondria in 12 ml assay buffer with PT inhibitors (10–20 µM cyclo-

sporin A) for 30 min before adding the PT inducers for the required time. 1

2.Label the mitochondria with the Rh123

(5 µM) for 10 min at room temperature. 2 Read on a FACS in FL1.

Notes

1 The positive control for m loss is CCCP (50–100 µM final). There will be a shift in fluorescence with a change in m.

2 Other dyes that can be utilized include DiOC6 (3) (25 nM : mitochondria or 40 nM : cells), or JC-1 (5 µg/ml : mitochondria or 1 µM : cells). JC-1 fluoresces green when it is a monomer but red when it aggregates about a mitochondria with high m.